Conformational Dynamics of RNA G4C2 and C2G4 Repeat Expansions causing ALS/FTD using NMR and Molecular Dynamics Studies

RNA G4C2 and C4G2 repeat expansions in the chromosome 9 open reading frame 72 gene (C9orf72) are the most common cause of genetically defined amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), referred to as c9ALS/FTD. The gene is bidirectionally transcribed, producing G4C2 repeats, r(G4C2)exp, in the sense and C4G2 repeats, r(C4G2)exp, in the antisense strands. Akin to other repeat expansions, those operating in c9ALS/FTD are highly structured, which contributes to their gain-of-function mechanism. Structural studies have revealed that r(G4C2)exp predominantly folds into a hairpin, which has periodic arrays of 1×1 G/G internal loops and a G-quadruplex. Recent studies on small molecule probes revealed that r(G4C2)exp adopts a new hairpin structure in which the 1×1 G/G internal loops transform into 2×2 GG/GG internal loops. We first evaluated the performance of four different RNA force fields with conventional MD simulations and showed that only the one having revised χ and α/γ torsional parameters maintained the helicity of a model r(G4C2)2. We then used this force field to study the conformational dynamics adopted by 2×2 GG/GG loops in a model system of r(UCUGGGGCCAGA)2 using temperature replica exchange molecular dynamics (T-REMD) simulations covering over 1.7 ms cumulative simulation time. We further characterized the structure and underlying dynamics of these internal loops using traditional 2D NMR techniques, illustrating the possibility of adopting different configurations around the glycosidic bond, i.e., anti vs. syn, using a hairpin model, r(CCAGGGCAAGGAAACUUGGGCUGG). Results display that closing base pairs play an important role in the structure and dynamics of these systems with the most preferred configuration being in syn-anti/anti-syn and anti-syn/anti-syn. Analogous studies on r(C4G2) repeats, which fold into an array of 2×2 CC/CC internal loops, revealed that this structure is not as dynamic as 2×2 GG/GG internal loops, where the residues adopt all anti configurations, although the dynamics of the loop residues is affected by the closing base pairs. Collectively, these studies emphasize the unique sensitivity of r(G4C2)exp to small changes in stacking interactions, which is not observed in r(C4G2)exp, providing important considerations for further principles in structure-based drug design.